Molecular characterization of chitinase and β-1, 3-glucanase gene of soybean plant growth promoting bacterium Bacillus sp. SJ-5

 

Shekhar Jain¹, Sarita Kumari¹, Anukool Vaishnav¹, Devendra Kumar Choudhary², Kanti Prakash Sharma¹*

¹Department of Biosciences, College of Arts, Science & Humanities (CASH), Mody University of Science & Technology, Lakshmangarh-332311, Rajasthan, India

²Amity Institute of Microbial Technology (AIMT), Block ‘E-3’, 4th Floor, Amity University Campus, Sector-125, Noida-201313, Gautam Buddha Nagar, UP, India

*Author to whom correspondence should be addressed; Department of Biosciences, College of Arts, Science & Humanities (CASH), Mody University of Science & Technology, Lakshmangarh-332311, Rajasthan, India

E-Mail: kantipsharma@rediffmail.com

Received: Oct 2016 / Accepted:  Oct2016/ Published: Dec 2016

ABSTRACT: Plant-growth-promoting bacteria (PGPB) colonize the rhizosphere of many plant species and confer beneficial effects, such as increased plant growth and reduced susceptibility to diseases caused by plant pathogenic fungi. The aim of the present study was to molecularly characterize the presence of biocontrol gene chitinase and β-1, 3-glucanase of the Bacillus sp. SJ-5 to understand its role in fungal pathogen inhibition. Genomic DNA was isolated from Bacillus sp. SJ-5 and chitinase and β-1, 3-glucanase gene were amplified using specific primers. On the agarose gel 402 pb and750 bp bands were detected for chitinase and β-1, 3-glucanase respectively. Upon homology analysis it confirms the presence of chitinase and β-1, 3-glucanase gene in SJ-5 and sequences submitted to Genbank. The study indicates the potential of this PGPB to inhibit fungal pathogen through cell wall degrading enzymes production.

Keywords: Plant growth promoting bacteria, Soybean, Chitinase, β-1, 3-glucanase

INTRODUCTION

Soybean, being a nutrient rich plant with a wide range of beneficial effect on human health and by product, also had a wide range of enemy in the form of different pathogens that affect it in different manner to reduce its quality as well as quantity. Several pathogens like fungi, bacteria, viruses and nematodes attack on the soybean plant and cause different disease leading to the great losses in the yield. Among the notable fungal diseases, Fusarium rot known as ‘Fusarium wilt and necrosis of root and lower of soybean’ and ‘Rhizoctonia root rot’ are the most destructive diseases of the crop and are very common also (Hashem et al. 2009). Chitin and β-glucans are the major constituents of the fungal cell wall. Plant growth promoting bacteria (PGPB) have the ability to reduce or prevent deleterious effect of pathogen by means of production of some antibiotics, cell wall degrading enzymes, competition for the niche etc.( Pandya et al.,  2015; Saini et al.,  2015; Hayat et al.,  2010; Bhattacharyya and Jha 2012; Coutinho et al.,  2015). Compant et al., (2005) reported that the biocontrol capacity of the PGPB strains is because of their capacity to produce chitinase and β-1, 3-glucanase. Chitinases are specific enzymes which can degrade the chitin by hydrolyzing β-glycosidic bonds. As chitin is the primary component of most of the fungal cell wall chitinase is directly correlated with it. Chang et al., (2007) reported that B.cereus QQ308 which had positive activity for different hydrolytic enzymes, including chitinase, chitosanase and protease, inhibited the growth of several important soil-borne fungal plant pathogens including F. oxysporum, F. solani, and P. ultimum in the form of culture itself or its culture supernatant. Production of chitinase, cellulase, pectinase, amylase, β-1, 3 glucanase, protease and lipase was reported in Pseudomonas sp. gave protection to tomato plants from fungal pathogens (Solanki et al. 2012). β-glucanase hydrolyses β-glucans, one of another major component of fungal cell wall. Kumar et al.,  (2012) isolated four bacterial strain namely Bacillus sp. BPR1, BPR3, BPR4 and BPR 7 with positive glucanase activities as it grew on laminarin azure-amended minimal medium. The aim of the present study was to molecularly characterize cell wall degrading enzymes gene β-1, 3-glucanase and chitinase of Bacillus sp. SJ-5 to find out these enzymes role in inhibition of fungal pathogen F. oxysporum and R. solani.

 

MATERIALS AND METHODS

BACTERIAL CULTURE

Plant growth promoting bacterial strain Bacillus sp. SJ-5 (MCC-2609), isolated from the soybean rhizospheric soil, was used for the study and maintained on nutrient agar plates for short term while for long time, preserved on nutrient broth (NB, HiMedia, India) amended with 50 % glycerol at -80°C.

 

BACTERIAL GENOMIC DNA ISOLATION

Bacterial genomic DNA was isolated by Bollet et al., (1991) method with little modification. For the DNA isolation, 24 h old culture, grown in NB was used after centrifugation. Quantitative estimation of the DNA was done spectrophotometrically by using biophotometer (Eppendorf, India) that is based on Beer Lamberts law while for the qualitative estimation agarose gel electrophoresis was performed and observation for the DNA band was done by visualizing gel for the DNA band in UVITECH gel doc system.

 

MOLECULAR CHARACTERIZATION OF BIOCONTROL GENES

PCR amplification of chitinase and β-1,3-glucanase genes responsible for biocontrol against fungal pathogens were done from genomic DNA of the bacterium isolate SJ-5 by using gene specific primer (GSP) designed online by Primer3 tool, available online at the site http://primer3.ut.ee/ and custom synthesized by Sigma Aldrich. The 25 μl of reaction mixture consisted of 100 ng of genomic DNA, 1 μl Taq polymerase (3U/ul), 2 μl of 10× buffer, 2 μl dNTP mix (10mM), 2 μl MgCl2 (25mM) and 1 μl of each primer (10 pmol/μl). Chitinase gene was amplified by using primer: cbF–GAATATCCTGGCGTTGAAACGAT and cbR– GCCACGTCCGTAAAAGGGT with PCR condition : initial denaturation at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 59°C for 30 sec, extension at 72°C for 1 min and a final extension at 72°C for 10 min. Another gene β-1, 3-glucanase was amplified by using primer: gbF– TGGCACACCATACGAAAGAA and gbR– AGATGCTTGTCCATCACCTAAC with PCR condition: initial denaturation at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 62°C for 45 sec, extension at 72 °C for 1 min and a final extension at 72°C for 10 min. For the assessment of both genes PCR product was loaded in the 1.2 % agarose gel (wt/vol) containing EtBr and ran for 45 min at 85 Volts in 1X TAE buffer. Observation for the DNA band was done by visualizing gel for the DNA band in UVITECH gel doc system.

 

PCR PRODUCT PURIFICATION AND SEQUENCING

Obtained PCR production was purified using Promega kit ‘Wizard® SV Gel and PCR Clean-Up System’ as per manufacturers instruction. Purified PCR product was checked quantitatively and qualitatively through biophotometer and gel electrophoresis respectively, and Sanger sequencing was done at National Chemical Laboratory (NCL), Pune by using ABI 3730xl DNA analyzer (Applied Biosystem, USA).

 

SEQUENCE HOMOLOGY ANALYSIS AND SEQUENCE SUBMISSION

Homology analysis of the sequences obtained through sequencing for different PGP and biocontrol genes were done by using BLAST tool of NCBI. Based on maximum identity score first five sequences were selected for further analysis. Selected sequences were aligned using Clustal W and checked for the gap. Phylogenetic and molecular evolutionary analysis of all the genes was performed using MEGA 6 software (Tamura et al 2013). Upon confirmation of the genes; sequences were submitted to NCBI Genbank and accession number assigned by NCBI.

 

RESULTS

MOLECULAR CHARACTERIZATION OF BIOCONTROL GENES OF BACTERIA

Molecular characterization of biocontrol properties of bacterium SJ-5 was done by amplifying biocontrol genes, chitinase and β-1, 3-glucanase of SJ-5 by using GSP. Gene amplification using GSP showed sharp bands of the specific genes near to desired amplicon size (Fig 1). For the chitinase gene a 402 bp sharp band was detected while for the β-1, 3-glucanase gene a 750 bp band was observed on the agarose gel under the UVITECH gel doc system.

 

 

Fig 1 PCR amplification of biocontrol genes of Bacillus sp. SJ-5; Lanes M-Marker (100 bp plus, Thermo scientific); 1- β-1, 3-glucanase; 2- Chitinase

 

SEQUENCE HOMOLOGY ANALYSIS AND SEQUENCE SUBMISSION

Sequence homology analysis of the concerned gene, confirmed the amplification of the desired gene. On the BLAST analysis both gene sequences have shown similarity with the concern gene of the Bacillus sp. In phylogenetic analysis, chitinase and β-1, 3-glucanase genes sequence of SJ-5 were grouped with respective gene of other Bacillusisolates as a single cluster (Fig 2). The chitinase and β-1, 3-glucanase gene sequences were dully submitted in NCBI Genbank with accession no. KT263585 and KU183550, respectively.

 

Fig.2 Phylogenetic analysis of biocontrol genes of Bacillus sp. SJ-5

 

DISCUSSION

Due to rapid growth, easy handling and aggressive colonization of the rhizosphere, antagonistic bacteria are considered ideal biological control agents against phytopathogens. Research studies have shown that use of PGPR specifically as biocontrol agents against soil borne fungal plant pathogens is the best alternative or complementary strategy to physical and chemical disease management (Saraf et al.,  2014; Berg and Smalla 2009; Haas and Defago 2005). In our previous study we found strong antifungal activity of Bacillus sp. SJ-5 against both fungal pathogens as it inhibits growth of F. oxysporum as well as R. solani on dual culture plate (Jain et al., 2016). Based on different research studies Bacillus sp. reported with potent antagonistic activity against different fungal phytopathogens to provide protection to host plants from invading pathogens and promote plant growth (Kumar et al. 2012; Walia et al.,  2013; Reyes-Ramirez et al.,  2004; Seo et al.,  2012). Direct antifungal activity of the Bacillus sp. is due to the presence of cell wall degrading enzymes such as chitinase, β-1, 3 glucanase, protease etc. and some of the antibiotic compounds such as Bacillomycin, Fengycin, Iturin A, Mycosubtilin, Zwittermicin A etc. ( Leclere et al.,  2005; Kloepper et al.,  2004; Koumoutsi et al.,  2004). Chen et al., (2004) have proven the role of chitinase in antifungal activity by transforming chiA gene of B. circulans WL-12 in to B. subtilis F29–3 and found enhanced antifungal activity of the culture supernatant against the Botrytis elliptica. Chitinases are glycosyl hydrolases that catalyze the hydrolytic degradation of chitin, an insoluble linear β-1, 4-linked polymer of N-acetylglucosamine (GlcNAc) that form one of the major constituent of the fungal cell wall (Bhattacharya et al. 2007) while the another cell wall degrading enzymes β-1, 3 glucanase catalyzes the hydrolysis of glucans, another major constituent of the fungal cell wall, with 1, 3-β-linkage and has an endolytic mode of action (Hong and Meng 2003).

Comparative studies have been done between the two chitinolytic bacteria B. thuringiensis NM101-19 and B. licheniformis NM120-17 isolated from the rhizosphere and found B. thuringiensis NM101-19 more effective than that of B. licheniformis in increasing the germination of soybean seeds infected with various phytopathogenic fungi (Gomaa 2012). Foliar spray of chitinolytic bacteria B. circulans GRS 243 and S. marcescens GPS 5 with 1% colloidal chitin on the Arachis hypogaea resulted in reduced lesion frequency by 60% compared with application of bacterial cells alone against the late leaf spot (LLS), caused by Phaeoisariopsis personata (Kishore et al.,  2005). Yan et al. (2011) have purified chitinase by sepharose fast flow ion exchange column chromatography and Sephadex G-75 gel filtration and characterized from the B. subtilis SL-13 which found to be promote sprouting and seedling growth of tomato and control Rhizoctonia rot caused by R. solani. β-1, 3-glucanase purified from the culture medium of a PaeniBacillus strain and Streptomyces sioyaensis were found to have the ability to damage the cell-wall structures of the growing mycelia of phytopathogenic fungi P. aphanidermatum and R. solani AG-4, but the PaeniBacillus enzyme reported to have a much stronger effect on inhibiting the growth of fungi tested (Hong and Meng 2003). Apart from these, P. cepacia having β-1,3 glucanase activity but no chitinolytic activity was also found with decreased in the incidence of diseases caused by R. solani, Sclerotium rolfsii and P. ultimwn by 85, 48 and 71%, respectively (Fridlender et al. 1993). PaeniBacillus  sp. 300 found positive for the chitinase and β-1,3-glucanase enzymes activity when supplemented with colloidal chitin as carbon source, suppressed Fusarium wilt of cucumber (Cucumis sativus) caused by F. oxysporum f. sp. cucumerinum in nonsterile, soilless potting medium (Singh et al. 1999). Earlier He et al., (1994) have purified zwittermicin A from the B. cereus UW85 and showed its antifungal activity against P. medicaginiscausing agent of damping-off disease of alfalfa through reversibly reduction in elongation of germ tubes derived from cysts. In the present study we have molecularly characterize chitinase and β-1,3-glucanase gene of SJ-5 to understood mechanism behind our previous study regarding pathogen suppression by SJ-5 (Jain et al.,  2016).

 

CONCLUSION

This study has provided an insight into the role of bacterial isolate SJ-5 in the fungal pathogen suppression by production of cell wall degrading enzymes to protect soybean plant. These studies show that the bacterium SJ-5 possesses chitinase and β-1, 3-glucanase gene and by using these it can inhibit fungal pathogen and promote soybean plant growth in indirect manner. This bacterium may be used as efficient PGPB for soybean production in farmer’s fields. It is an environment friendly and cost effective technology.

 

ACKNOWLEDGEMENT

Authors would like to acknowledge Dr. Yogesh Shouche (Scientist ‘G’, NCCS Pune) for providing sequencing facility. The research was supported by DBT Grant No.BT/PR1231/AGR/21/340/2011 to DKC. Some of the research has been supported by SERB-DST Grant No. SR/FT/LS-129/2012 to DKC.

 

REFERENCES

1.        Berg G, Smalla K, 2009. Plant species and soil type cooperatively shape the structure and function of microbial communities in the rhizosphere. FEMS Microbiol Ecol. 68(1):1-3.

2.        Bhattacharyya PN, Jha DK, 2012. Plant growth-promoting rhizobacteria (PGPR): emergence in agriculture. World J Microbiol Biotechnol. 28(4):1327-50.

3.        Bollet C, Gevaudan MJ, de Lamballerie X, Zandotti C, de Micco P, 1991. A simple method for the isolation of chromosomal DNA from Gram positive or acid fast bacteria. Nucleic Acids Res. 19:1955.

4.        Chang WT, Chen YC, Jao CL, 2007. Antifungal activity and enhancement of plant growth by Bacillus cereus grown on shellfish chitin wastes. Bioresource technol. 98(6):1224-30.

5.        Chen CY, Wang YH, Huang CJ, 2004. Enhancement of the antifungal activity of Bacillus subtilis F29-3 by the chitinase encoded by Bacillus circulans chiA gene. Canad J microbiol. 50(6):451-4

6.        Compant S, Duffy B,  Nowak J, Cle´ment C, Ait Barka  E, 2005. Use of Plant Growth-Promoting Bacteria for Biocontrol of Plant Diseases: Principles, Mechanisms of Action, and Future Prospects. Appl Environ Microbiol. 71:4951–4959

7.        Coutinho BG, Licastro D, Mendonça-Previato L, Cámara M, Venturi V, 2015. Plant-influenced gene expression in the rice endophyte Burkholderia kururiensis M130. Mol Plant-Microbe Inter. 28(1):10-21.

8.        Fridlender M, Inbar J, Chet I, 1993. Biological control of soil borne plant pathogens by a β-1, 3 glucanase-producing Pseudomonas cepacia. Soil Biol Biochem. 25(9):1211-21

9.        Gomaa EZ, 2012. Chitinase production by Bacillus thuringiensis and Bacillus licheniformis: their potential in antifungal biocontrol, The J Microbiol. 50(1):103-11

10.     Haas D, Défago G 2005. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nature Rev Microbiol. 3(4):307-19.

11.     Hashem EA, Abdalla HE, Hussein YA, Abd-Elnabi MA, 2009. In vitro selection of soybean callus resistant to Fusarium oxysporum metabolites. Res J Agric Biol Sci. 5(4):588–596

12.     Hayat R, Ali S, Amara U, Khalid R, Ahmed I, 2010. Soil beneficial bacteria and their role in plant growth promotion: a review. Ann Microbiol. 60(4):579-98.

13.     He H, Silo-Suh LA, Handelsman J, Clardy J, 1994. Zwittermicin A, an antifungal and plant protection agent from Bacillus cereus. Tetrahedron letters. 35(16):2499-502

14.     Hong TY, Meng M, (2003. Biochemical characterization and antifungal activity of an endo-1, 3-β-glucanase of PaeniBacillus  sp. isolated from garden soil. Appl microbiol Biotechnol. 61(5-6):472-8

15.     Jain S, Vaishnav A, Kumari S, Varma A, Tuteja N, Choudhary DK, 2016. Chitinolytic Bacillus-Mediated Induction of Jasmonic Acid and Defense-Related Proteins in Soybean (Glycine max L. Merrill) Plant Against Rhizoctonia solani and Fusarium oxysporum. J Plant Growth Regul,1-5, doi:10.1007/s00344-016-9630-1

16.     Kishore GK, Pande S, Podile AR, 2005. Biological control of collar rot disease with broad-spectrum antifungal bacteria associated with groundnut. Canad J microbiol. 51(2):123-32

17.     Kloepper JW, Ryu CM, Zhang SA, 2004. Induced systemic resistance and promotion of plant growth by Bacillusspp. Phytopatol. 94:1259–1266

18.     Koumoutsi A, Chen XH, Henne A, Liesegang H, Hitzeroth G, Franke P, Vater J, Borriss R, 2004. Structural and functional characterization of gene clusters directing nonribosomal synthesis of bioactive cyclic lipopeptides in Bacillus amyloliquefaciens strain FZB42. J bacteriol. 186(4):1084-96.

19.     Kumar P, Dubey RC, Maheshwari DK, 2012. Bacillus strains isolated from rhizosphere showed plant growth promoting and antagonistic activity against phytopathogens. Microbiol res. 167(8):493-9.

20.     Leclère V, Béchet M, Adam A, Guez JS, Wathelet B, Ongena M, Thonart P, Gancel F, Chollet-Imbert M, Jacques P, 2005. Mycosubtilin overproduction by Bacillus subtilis BBG100 enhances the organism’s antagonistic and biocontrol activities. App environm microbiol. 71(8):4577-84.

21.     Pandya M, Rajput M, Rajkumar S, 2015. Exploring plant growth promoting potential of non rhizobial root nodules endophytes of Vigna radiata. Microbiol. 84(1):80-89.

22.     Reyes‐Ramírez A, Escudero‐Abarca BI, Aguilar‐Uscanga G, Hayward‐Jones PM, Barboza‐Corona JE, 2004. Antifungal activity of Bacillus thuringiensis chitinase and its potential for the biocontrol of phytopathogenic fungi in soybean seeds. J food sci,. 69(5):M131-4.

23.     Saini R, Dudeja SS, Giri R, Kumar V, 2015. Isolation, characterization, and evaluation of bacterial root and nodule endophytes from chickpea cultivated in Northern India. J basic microbiol. 55(1):74-81.

24.     Saraf M, Pandya U, Thakkar A, 2014. Role of allelochemicals in plant growth promoting rhizobacteria for biocontrol of phytopathogens. Microbiol res. 169(1):18-29.

25.     Seo DJ, Song YS, 2012. Induction of defense response against Rhizoctonia solani in cucumber plants by endophytic bacterium Bacillus thuringiensis GS1. J microbiol Biotechnol. 22(3):407-15.

26.     Singh PP, Shin YC, Park CS, Chung YR, 1999. Biological control of Fusarium wilt of cucumber by chitinolytic bacteria. Phytopathol. 89(1):92-9

27.     Solanki MK, Robert AS, Singh RK, Kumar S, Pandey AK, Srivastava AK, Arora DK, 2012. Characterization of mycolytic enzymes of Bacillus strains and their bio-protection role against Rhizoctonia solani in tomato. Cur microbiol. 65(3):330-6.

28.     Walia A, Mehta P, Chauhan A, Shirkot CK, 2013. Antagonistic activity of plant growth promoting rhizobacteria isolated from tomato rhizosphere against soil borne fungal plant pathogens. Inter J Agri Environ Biotechnol. 6(4):571.

29.     Yan LI, Jing TA, Yujun YA, Bin LI, Hui LI, Chun LI, 2011. Biocontrol efficiency of Bacillus subtilis SL-13 and characterization of an antifungal chitinase. Chin J Chemical Eng. 19(1):128-34

 

 

How to cite this article

Jain, S., Kumari, S., Vaishnav, A., Choudhary, D. K., & Sharma, K. P. (2016). Molecular characterization of chitinase and β-1, 3-glucanase gene of soybean plant growth promoting bacterium Bacillus sp. SJ-5. International Journal of Agricultural and Life Sciences, 2(4), 54-59. doi: 10.22573/spg.ijals.016.122066

 

 

 

CONFLICTS OF INTEREST

“The authors declare no conflict of interest”.

 

© 2016 by the authors; licensee SKY FOX Publishing Group, Tamilnadu, India. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).